<?xml version="1.0" encoding="utf-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "https://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <article-meta>
      <title-group>
        <article-title>Organizational Safety Culture and Employee Engagement Drive Production Performance</article-title>
        <subtitle>Budaya Keselamatan Organisasi dan Keterlibatan Karyawan Mempengaruhi Kinerja Produksi</subtitle>
      </title-group>
      <contrib-group content-type="author">
        <contrib contrib-type="person">
          <name>
            <surname>Jasim</surname>
            <given-names>Abbas Ridha</given-names>
          </name>
          <email>abbasridha94@gmail.com</email>
          <xref ref-type="aff" rid="aff-1"/>
        </contrib>
        <contrib contrib-type="person">
          <name>
            <surname>Sahib</surname>
            <given-names>Hussein. A</given-names>
          </name>
          <email>abbasridha94@gmail.com</email>
          <xref ref-type="aff" rid="aff-2"/>
        </contrib>
      </contrib-group>
      <aff id="aff-1">
        <institution>Department of Clinical Pharmacology and Therapeutics, University of Al-Qadisiya, College of Medicine</institution>
        <country>Iraq</country>
      </aff>
      <aff id="aff-2">
        <institution>Department of Clinical Pharmacology and Therapeutics, University of Al-Qadisiya, College of Medicine</institution>
        <country>Iraq</country>
      </aff>
      <history>
        <date date-type="received" iso-8601-date="2025-12-24">
          <day>24</day>
          <month>12</month>
          <year>2025</year>
        </date>
      </history>
    <pub-date pub-type="epub"><day>12</day><month>12</month><year>2025</year><volume>2</volume></pub-date></article-meta>
  </front>
  
  
<body id="body">
    <sec id="heading-3c43f769e5979d9e8e186c8a77f482c9">
      <title>
        <bold id="bold-0afc397f3889a15b6010dc8e372a8cc2">Introduction</bold>
      </title>
      <p id="_paragraph-12">Chronic Myeloid Leukemia (CML) is a myeloproliferative neoplasm with an annual incidence of two cases per 100,000, constituting about 15% of newly diagnosed adult leukemia cases. The CML-specific mortality rate is low, at 0.5%–1%. CML was the first cancer linked to a chromosomal defect, specifically the Philadelphia chromosome (Ph), which arises from the reciprocal translocation t(9;22). This translocation fuses the Abelson murine leukemia (ABL) gene on chromosome 9 with the Breakpoint Cluster Region (BCR) gene on chromosome 22, creating the BCR-ABL oncogene. This hybrid gene produces a constitutively active tyrosine kinase oncoprotein, which drives the uncontrolled growth and division of CML cells.<xref id="_xref-1" ref-type="bibr" rid="bib1">[1]</xref></p>
      <p id="_paragraph-13">The standard treatment for CML involves Tyrosine Kinase Inhibitors (TKIs), a class of pharmaceutical drugs approved by the FDA that interfere with protein kinase signal transduction pathways. The BCR gene contains several breakpoint regions (M-BCR, m-BCR, μ-BCR), which determine the type of BCR-ABL transcript produced. The most common transcripts in CML are e13a2 and e14a2, both encoding the p210 oncoprotein, which possesses the constitutive tyrosine kinase activity central to leukemogenesis.<xref id="_xref-2" ref-type="bibr" rid="bib2">[2]</xref></p>
      <p id="_paragraph-14">Non-coding RNAs, unlike coding RNAs (like mRNA), regulate various levels of gene expression without encoding proteins. MicroRNAs (miRNAs) are a category  of small , single-stranded, non-coding RNAs (approximately 22–23 nucleotides long) that act post-transcriptionally. Their primary function is to control biological processes by "silencing" genes, typically by promoting mRNA degradation or repressing its translation. However, the function of miRNAs is complex; they can also indirectly increase protein expression by breaking down natural inhibitors of certain mRNAs.<xref id="_xref-3" ref-type="bibr" rid="bib3">[3]</xref></p>
      <p id="_paragraph-15">MicroRNA-21 (miR-21) is  the most frequently upregulated miRNAs of cancer, often referred to as an oncomiR. It targets multiple tumor suppressor genes linked to apoptosis, invasion, and proliferation, thereby contributing to tumorigenesis. Studies have suggested that miR-21 is linked to chemotherapy resistance and functions as a pro-survival and anti-apoptotic factor. Higher levels of miR-21 expression have been reported in CML patients compared to healthy controls at diagnosis, with expression levels correlating with disease stage (higher in CML-BP and lower from CML-AP to CML-CP). The findings propo a potential role for miR-21 as a biomarker for diagnosis and prognosis in CML, and some authors have reported that Imatinib reduces miR-21 expression, suggesting its potential for monitoring therapy response.<xref id="_xref-4" ref-type="bibr" rid="bib4">[4]</xref></p>
      <p id="_paragraph-16">Given the conflicting or evolving understanding of miR-21's role in CML treatment response, the objective of this study was to assess the correlation between microRNA-21 (miR-21) expression levels and the clinical response to Tyrosine Kinase Inhibitor (TKI) therapy in CML patients under treatment.</p>
    </sec>
    <sec id="heading-5448660ac030bf09a8965b5a7723bc02">
      <title>
        <bold id="bold-abcb20d55c7168f769dfea8ec13f82c5">Materials and Methods</bold>
      </title>
      <p id="_paragraph-18">
        <bold id="bold-c295b052b6a8b71a594e6b6a5a97143d">2.1. Study Design and Patient Population</bold>
      </p>
      <p id="_paragraph-19">The present  research was designed as a cross-sectional, single center examination. The research carried out in collaboration between the Hematological Consultant unit at Al-Diwaniyah General Hospital and the Department of Pharmacology and Therapeutics, Faculty of Medicine, University of Al-Qadisiya , Iraq. The study duration was five months, from October 2024 to February 2025.</p>
      <p id="_paragraph-20">The study included <bold id="bold-eea4c5efaf09f7ad2b775ebe23e0bfc5">50 patients</bold> diagnosed with Philadelphia chromosome-positive CML. All recruited patients were currently receiving at least one type of TKI treatment and had comprehensive clinical and laboratory records available for review.</p>
      <p id="_paragraph-21">
        <bold id="bold-a628263f3179f872cf4bd75611cf4671">2.2. TKI Treatment and Response Criteria</bold>
      </p>
      <p id="_paragraph-22">All patients included in the study were receiving Tyrosine Kinase Inhibitor (TKI) therapy, including Imatinib<bold id="_bold-1">, </bold>Nilotinib<bold id="_bold-2">,</bold> andBosutinib, as first- or second-line treatment for CML. The specific TKI and dosage were determined by the treating physician based on standard clinical guidelines. Patients had been on TKI therapy for a minimum of 12 months.</p>
      <p id="_paragraph-23">The Patients were categorized into two groups according to  their molecular response to TKI therapy, following the European LeukemiaNet (ELN) 2020 recommendations [10]:</p>
      <list list-type="bullet" id="list-2d431e4a1245f691ab83f8b01308f008">
        <list-item>
          <p><bold id="bold-7b632260c39bf2cd8e604c285cb89cc7">Good Response Group (n=29)</bold><bold id="bold-e5ff3442e99adf0223e35679a8d3e4b8">: </bold>Patients who achieved an optimal response, defined as Major Molecular Response (MMR) (BCR-ABL1 ≤ 0.1% on the International Scale (IS)) at 12 months or later.</p>
        </list-item>
        <list-item>
          <p><bold id="bold-ced899060695812cdd760ea65c4c3064">Poor Response Group (n=21):</bold> Patients who showed a warning or failure response, defined as achievement failure MMR (BCR-ABL1 ≥ 0.1% IS) at 12 months or later, or those who experienced loss of response.</p>
        </list-item>
      </list>
      <p id="_paragraph-24">
        <bold id="bold-5076903d8bfd387d82464cb5ebbabcc7">2.2. Ethical Approval and Data Collection</bold>
      </p>
      <p id="_paragraph-25">The present study protocol was accepted by  the Ethics Research Committee of Al-Qadisiya University. Informed consent was obtained from each patient and control participant in accordance with the Declaration of Helsinki.</p>
      <p id="_paragraph-26">For diagnosis and follow-up, standard procedures included a complete blood count and molecular analysis of BCR-ABL1 by real-time quantitative PCR.</p>
      <p id="_paragraph-27">
        <bold id="bold-f4e10bba9d1b4ab5119bd3787be99ef1">2.4. Gene Expression Analysis of microRNA-21</bold>
      </p>
      <p id="_paragraph-28">
        <bold id="bold-ae3413563d339c4cbcd114a0ee9dabb1">Extraction of RNA and  Synthesis of cDNA</bold>
      </p>
      <p id="_paragraph-29">The entire RNA was taken from whole blood samples using <bold id="bold-8847c6c82bfe2924898441ea5ef036c0">T</bold><bold id="bold-3ded0a850520929968396d4656443b23">RIpure RNA extraction reagents (ELK, China)</bold> following the manufacturer's protocol, which involved lysis with Triazol, chloroform extraction, isopropanol precipitation, and 70% ethanol washing. RNA concentration was measured using the <bold id="bold-ee9b2013d9b80d89441c21ca9a1aaac7">Quantus™ Fluorometer (Promega, USA)</bold>. The extracted RNA was reverse transcribed into complementary DNA (cDNA) using the <bold id="bold-0e9d9f264efec8d4ec9b35ca9f178bb7">ADDBio kit</bold><bold id="bold-3a3cf72c4b7e5bfb412313dc4c9b4c5b"> (Korea)</bold>. The reaction of the mixture (20 μl total volume) included 4 μl of RNA and was incubated at 50°C for 60 minutes  for reverse transcription.</p>
      <p id="_paragraph-30">
        <bold id="bold-1c98af322cad2c3141c62497bf5a15c6">Quantitative Reverse Transcriptase PCR (RT-qPCR)</bold>
      </p>
      <p id="_paragraph-31">The expression level of microRNA-21 (miR-21) was quantified by RT-qPCR using the <bold id="bold-d9472e0569431bf8333ef5f33e520827">AddScript RT-qPCR Syber master (AddBio, Korea)</bold> on a<bold id="bold-55f642985574e110575e50c3dfaf031c"> BioRAD (USA)</bold> real-time qPCR machine. The housekeeping gene was <bold id="bold-43a1f172d03f76f3a2653ae2e691a659">GAPDH.</bold></p>
      <p id="_paragraph-32">
        <bold id="bold-8beba2a74a1f843461ba8467339eafa2">Primers used in this study:</bold>
      </p>
      <table-wrap id="tbl1">
        <label>Table 1</label>
        <caption>
          <p id="_paragraph-33"/>
        </caption>
        <table id="_table-1">
          <tbody>
            <tr id="table-row-9ca22711641afd05b59cb5da7ecd8fdb">
              <th id="a098df7013add8b1354a9afe879544bd">
                <bold id="bold-93d2f14fd3f8cf8c6c951b9954619d80">Gene</bold>
              </th>
              <th id="6ba9a23b117a356359bad9e1fde92ab7">
                <bold id="bold-279cc308c834988be329333608633aae">Primer</bold>
              </th>
              <th id="4ab9c2b09f9a793d77eebc009876c7ea">
                <bold id="bold-2ecc04deb6706699a2f06019f4eaa5d1">Sequence (5'-&gt;3')</bold>
              </th>
            </tr>
            <tr id="table-row-7f9260021381880daa1ee8a2c8984630">
              <td id="848b41aba1abafbb975652bf54029fcd">
                <bold id="bold-ee72b7a2736ea5ba7ef6fe4d55a403c6">House Keeping Gene (GAPDH)</bold>
              </td>
              <td id="7665db3196bbeb12a2258be5dc626483">Forward</td>
              <td id="feda92658b978a475bff156008798897">GAAGGTGAAGGTCGGAGTC</td>
            </tr>
            <tr id="table-row-bee7c8e13da44aec4a49ce5fab571dd7">
              <td id="c6fe7f5e0b1796246d0ad619cecc8437"/>
              <td id="df15cf92de747eb91d3c478ffcef24d2">Reverse</td>
              <td id="99f0dd17085b1ce81c6fa324ff5156d0">GAAGATGGTGATGGGATTTC</td>
            </tr>
            <tr id="table-row-9256edc2cc32e0ea8d4a10a2d2ac63b2">
              <td id="84ba7f03c080bb38859e118385c35ef2">
                <bold id="bold-2e6eb350486de3ade2fdb32f4f402a74">Gene of Interest (miRNA-21)</bold>
              </td>
              <td id="d548cee69cde0f15337ef0a0354f7acc">Forward</td>
              <td id="2c5747d36b76c4a9ee79ddad7b2bdb78">TTGTCGGGTAGCTTATC</td>
            </tr>
            <tr id="table-row-99747927a0a7b5d6b7425c4c5aac72eb">
              <td id="5ac7c646dec9d2fe617b3f4f964c72dd"/>
              <td id="966d5c6b9c81ff72e52a7fec3619f412">Reverse</td>
              <td id="4215d987fcf6337d9e3fb46837969428">GTCAGACAGCCCATCGA</td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <p id="_paragraph-34">The 20 μl reaction mix included 2 μl of cDNA and 2 μl of each primer (0.05 pmol/20 μl). The thermal cycling conditions were: primer denaturation at 95°C for 5 minutes , then forty cycles of denaturation (95°C for 20 seconds ), annealing (60°C for 30 seconds ), then extension (72°C for 30 seconds). A melting curve study was conducted to ensure  product specificity</p>
      <p id="_paragraph-35">
        <bold id="bold-1ee42d744f6aa487e59eb5b591100967">Statistical Analysis</bold>
      </p>
      <p id="_paragraph-36">The gene expression levels of microRNA-21 were compared between these two groups using <bold id="bold-f5a13b9d7293ec2d481b6fb7be10a7d1">GraphPad Prism</bold> software. Statistical significance was determined by t-test analysis.</p>
    </sec>
    <sec id="heading-5ca54dd2c401b07b7b0819dc09852245">
      <title>
        <bold id="bold-5c5f618dd11ef328d7f6d8dc75e393b8">Results</bold>
      </title>
      <p id="_paragraph-38">
        <bold id="bold-40de1b76a71b8d24d9c4f4228559144c">3.1   miR-21 Expression and Treatment Response Parameters</bold>
      </p>
      <p id="_paragraph-39">The correlation between miRNA-21 expression levels and key parameters of treatment response (WBC, HB, PLT, molecular) was also assessed (Table 1). The analysis revealed no significant correlation between the expression of miRNA-21 and any of the measured treatment response parameters (p &gt; 0.05 for all).</p>
      <p id="_paragraph-40">
        <bold id="bold-6810a8e3acd1b161e58982263949b920">3.2 Comparison of miR-21 Expression Levels by TKI Response</bold>
      </p>
      <p id="_paragraph-41">The mean expression level of miRNA-21 was compared between the poor response group (n=21) and the good response group (n=29) (Table 2 and Figure 1).</p>
      <p id="_paragraph-42">The mean expression level of miRNA-21 was slightly higher in the poor response group (31.16 ± 4.89) compared to the good response group (29.88 ± 3.79). However, this difference was not statistically significant (p = 0.301).</p>
      <table-wrap id="tbl2">
        <label>Table 2</label>
        <caption>
          <title>Table 1. Correlations of miRNA-21 to Parameters of Treatment Response</title>
          <p id="_paragraph-44"/>
        </caption>
        <table id="_table-2">
          <tbody>
            <tr id="table-row-088cece270eda7aea1ab9a18c8a1dbdd">
              <th id="3b47b5995100fcc05e32adda7b40a5c5">
                <bold id="bold-7e070b7158c0ff6d9f7df491ddf870b3">Characteristic</bold>
              </th>
              <th id="78f7de31e9f157a2fec6dd75b4985020">
                <bold id="bold-ac820a66ed0d355317164c4ecf6defb9">miRNA-21 (r)*</bold>
              </th>
              <th id="a59caede96798a858fdb9271448f75ed">
                <bold id="bold-ee414a00569171a6cd835a0cee580805">miRNA-21 (p)*</bold>
              </th>
            </tr>
            <tr id="table-row-e4d6b5bab27151195be8fedd8e6cb844">
              <td id="86c756d065cb92292307c485864a79b7"> WBC</td>
              <td id="238fd30ebd5d1bf78fad18411f903652">0.121</td>
              <td id="d44b1a6fd5b7bc0949fad878ecb5add3">0.403</td>
            </tr>
            <tr id="table-row-99089c2af47bf82b3cae07fb402f4d9b">
              <td id="99dc03b48dcc62935b7263581264fb0f"> HB</td>
              <td id="90fa66c8879f95f4fcad19eb90a3bafa">0.198</td>
              <td id="002feb5b1183801c9f4bc2945bde8cbe">0.168</td>
            </tr>
            <tr id="table-row-683a825d4ab1abe9353394fdfd967055">
              <td id="203a488917bbdf2f45a942ab69313312"> PLT</td>
              <td id="d86568c42adf7bf7099a8ea94dae78fa">-0.018</td>
              <td id="84b7afa5bbf1f23d59f8899912265ef5">0.904</td>
            </tr>
            <tr id="table-row-8eb0d7b2b7c6970e6ef040b656fce183">
              <td id="c0e63c301e7535b3ce021e8d077ecef9"> molecular</td>
              <td id="1d49177571363e38d8240dd395a028d0">0.033</td>
              <td id="18e075d56818a4d609692d85aa3ea6f6">0.821</td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <p id="_paragraph-45">*(r )correlation coefficient, (p) p-value</p>
      <table-wrap id="tbl3">
        <label>Table 3</label>
        <caption>
          <title>Table 2. Comparison of Mean Expression Levels of miRNA-21 according to TKI Response</title>
          <p id="_paragraph-47"/>
        </caption>
        <table id="_table-3">
          <tbody>
            <tr id="table-row-c7b838acd97cc5791354ae5c1aee5fdd">
              <th id="731b416e4a6e4ae77d4f7a914e63f0e2">
                <bold id="bold-defa14c91ec4e2bcf06ba40c9c1ffa81">Characteristics</bold>
              </th>
              <th id="d3901c934076c2670f93cf1b3bbcdcc2">
                <bold id="bold-6035634609505475330013043ebd6aae">Poor response (n=21) Mean ±SD</bold>
              </th>
              <th id="0a4319c0b00131c8329d9089a9629699">
                <bold id="bold-a0a94ca3d2006335f205d223043a10d9">Good response (n=29) Mean ±SD</bold>
              </th>
              <th id="9a337041d947cbee7a98ac5ba9135c20">
                <bold id="bold-8339d0099ffe3284656caf906714ade8">p-value</bold>
              </th>
            </tr>
            <tr id="table-row-fb6f20f9fa4cbdb6287f2bc88c34553c">
              <td id="433ad941431c5b092e19d5336e206369">
                <bold id="bold-dddf7717dc74787f50a6873ba8449aa1">miRNA-21</bold>
              </td>
              <td id="e112fc834b4aa5d7e98be3a513732606">31.16 ± 4.89</td>
              <td id="6d9d3eba6e70e46bbbd75314222a6a22">29.88 ± 3.79</td>
              <td id="68c6c2da1520a85c1e1101db015f4d49">0.301</td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <fig id="fig1">
        <label>Figure 1</label>
        <caption>
          <title>Figure 1. Comparison of Mean Expression Levels of microRNA-21 (miR-21) according </title>
          <p id="_paragraph-48"/>
        </caption>
        <graphic id="_graphic-1" mimetype="image" mime-subtype="png" xlink:href="https://ijhsm.umsida.ac.id/index.php/ijhsm/article/download/340/344/2207"/>
      </fig>
      <p id="_paragraph-50">
        <bold id="bold-6dee9e64ef5bfce6c9e2c2302b7d95aa">to TKI Response</bold>
      </p>
      <sec id="heading-8666d6505e9c3f187610fdab1a2842fc">
        <title>
          <bold id="bold-de34e4350d8dc8bcc2bc1874810d379d">Discussion</bold>
        </title>
        <p id="_paragraph-52">The primary objective of the present study was to assess the prognostic significance of microRNA-21 (miR-21) expression levels in CML patients undergoing TKI therapy by comparing expression levels between patients with good and poor treatment responses. This study is particularly significant as research on CML and microRNA biomarkers is scarce in the Al-Diwaniyah region of Iraq, where local data on treatment response and prognostic factors are urgently needed [8] [9]. Our findings indicate that the mean expression level of miR-21 did not differ significantly between the two response groups (p = 0.301)</p>
        <p id="_paragraph-53">This result is particularly noteworthy as it contradicts a significant body of literature that has proposed miR-21 as a key oncomiR and a potential biomarker for TKI resistance in CML [1] [2] [3]. Several studies have reported that high levels of miR-21 are connected with resistance to Imatinib-induced apoptosis, often by focusing on tumor suppressor genes like PTEN or by activating the PI3K/AKT pathway [4] [5]. For instance, a study by Alves et al. (2019) concluded that miR-21 expression levels at diagnosis played a crucial role in predicting optimal response to TKI treatment [6].</p>
        <p id="_paragraph-54">The discrepancy between our findings and the existing literature may be attributed to several factors. Firstly, the timing of sample collection is a critical variable. Most studies that report a correlation between high miR-21 and poor response measure the expression levels at the time of diagnosis (pre-treatment) to predict future response [6] [7]. In contrast, our study measured miR-21 expression in patients who were already receiving TKI treatment (post-treatment). The original hypothesis in the Introduction section of this manuscript suggested that Imatinib may reduce miR-21 expression, which could potentially mask any initial prognostic difference. Our results, therefore, suggest that miR-21 expression levels afterthe initiation of TKI therapy may not be a reliable indicator of the current treatment outcome (good vs. poor response).</p>
        <p id="_paragraph-55">Finally, the study's limited  sample size (n=50) and its cross-sectional design may limit the power to detect subtle differences in expression levels. Despite these limitations, this study provides valuable baseline data from an underrepresented population in Iraq, contributing to the global understanding of CML management in diverse ethnic and geographical settings. Longitudinal studies tracking miR-21 expression from diagnosis through various stages of TKI response would be necessary to fully reconcile our findings with the broader literature.</p>
        <p id="_paragraph-56">In summary, while previous research strongly supports a role for miR-21 in the mechanism of TKI resistance, our data from CML patients already on TKI therapy suggest that the expression level of miR-21 is not a significant prognostic biomarker for distinguishing between good and poor responders in this specific clinical context.</p>
      </sec>
    </sec>
    <sec id="heading-8d0422077f6bba5bcd1f7f3fc4d3cb66">
      <title>
        <bold id="bold-f4bf3b82aa18de9d45bf409cc585d43d">Conclusion</bold>
      </title>
      <p id="_paragraph-58">Based on the analysis of 50 CML patients receiving TKI therapy, this study concludes that the expression level of microRNA-21 (miR-21) does not significantly correlate with the patient's response to Tyrosine Kinase Inhibitor treatment. The comparison of mean miR-21 expression between good and poor responders showed no statistically significant difference. Therefore, miR-21 expression, when measured post-treatment initiation, cannot be considered a promising biomarker for the prediction of TKI treatment response in CML patients. Further large-scale, longitudinal studies are recommended to clarify the role of miR-21 at different stages of TKI therapy.</p>
    </sec>
  </body><back>
    <ref-list>
      <ref id="bib1">
        <element-citation publication-type="journal">
          <page-range>261-277</page-range>
          <volume>14</volume>
          <year>2023</year>
          <pub-id pub-id-type="doi">10.2147/JBM.S382090</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Rinaldi</surname>
              <given-names>Ikhwan</given-names>
            </name>
            <name>
              <surname>Winston</surname>
              <given-names>Kevin</given-names>
            </name>
          </person-group>
          <source>Journal of Blood Medicine</source>
          <article-title>Chronic Myeloid Leukemia, from Pathophysiology to Treatment-Free Remission: A Narrative Literature Review</article-title>
        </element-citation>
      </ref>
      <ref id="bib2">
        <element-citation publication-type="journal">
          <issue>April</issue>
          <page-range>1648-1671</page-range>
          <year>2016</year>
          <pub-id pub-id-type="doi">10.1038/leu.2016.104</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Steegmann</surname>
              <given-names>J L</given-names>
            </name>
            <name>
              <surname>Baccarani</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Breccia</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Casado</surname>
              <given-names>L F</given-names>
            </name>
            <name>
              <surname>Hochhaus</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Kim</surname>
              <given-names>D-w</given-names>
            </name>
            <name>
              <surname>Kim</surname>
              <given-names>T D</given-names>
            </name>
            <name>
              <surname>Khoury</surname>
              <given-names>H J</given-names>
            </name>
            <name>
              <surname>Coutre</surname>
              <given-names>P</given-names>
            </name>
          </person-group>
          <source>Nature Publishing Group</source>
          <article-title>European LeukemiaNet recommendations for the management and avoidance of adverse events of treatment in chronic myeloid leukaemia</article-title>
        </element-citation>
      </ref>
      <ref id="bib3">
        <element-citation publication-type="journal">
          <issue>8</issue>
          <page-range>2379-2383</page-range>
          <volume>20</volume>
          <year>2019</year>
          <pub-id pub-id-type="doi">10.31557/APJCP.2019.20.8.2379</pub-id>
          <pub-id pub-id-type="pmid">10.31557/APJCP.2019.20.8.2379</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Mirza</surname>
              <given-names>Masroor Ali Beg</given-names>
            </name>
            <name>
              <surname>Guru</surname>
              <given-names>Sameer Ahmad</given-names>
            </name>
            <name>
              <surname>Abdullah</surname>
              <given-names>Saleh Mohammed</given-names>
            </name>
            <name>
              <surname>Rizvi</surname>
              <given-names>Aliya</given-names>
            </name>
            <name>
              <surname>Saxena</surname>
              <given-names>Alpana</given-names>
            </name>
          </person-group>
          <source>Asian Pacific Journal of Cancer Prevention</source>
          <article-title>microRNA-21 expression as prognostic and therapeutic response marker in chronic myeloid leukaemia patients</article-title>
        </element-citation>
      </ref>
      <ref id="bib4">
        <element-citation publication-type="journal">
          <issue>2</issue>
          <page-range>229-234</page-range>
          <volume>18</volume>
          <year>2014</year>
          <pub-id pub-id-type="doi">10.4103/0973-029X.140762</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Ranganathan</surname>
              <given-names>Kannan</given-names>
            </name>
            <name>
              <surname>Sivasankar</surname>
              <given-names>Vaishnavi</given-names>
            </name>
          </person-group>
          <source>Journal of Oral and Maxillofacial Pathology</source>
          <article-title>MicroRNAs - Biology and clinical applications</article-title>
        </element-citation>
      </ref>
    </ref-list>
  </back></article>
